View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16796_high_22 (Length: 308)
Name: NF16796_high_22
Description: NF16796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16796_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 22 - 296
Target Start/End: Original strand, 48123658 - 48123932
Alignment:
| Q |
22 |
gtacattgccacaattgtacataggataaggaagatgaaggttgcataacaaactagttgagaaaagccatgaggatctctagggcaacaacagtaacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48123658 |
gtacattgccacaattgtacataggataaggaagatgaaggttgcataacaaactagttgagaaaagccatgaggatctctagggcaacaacagtaacac |
48123757 |
T |
 |
| Q |
122 |
acacaaatgatgtgtaaaacaagcccaaaaaccaccaaccatgttgcagcaacaacaaagaaaggaactgctgtagaaagaacagactgcactacgacaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
48123758 |
acacaaatgatgtgtaaaacaagcccaaaaaccaccaaccatgttgcagcaacaacgaagaaaggaactgctgtagaaagaacagactgcaccaagacaa |
48123857 |
T |
 |
| Q |
222 |
caacaatttaaagttaacaatacaaactcaaacatgaaataaccaattaaaatgcaggtgtattttccatatatt |
296 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48123858 |
cagcaatttaaagttaacaatacaaactcaaacatgaaataaccaattaaaatgcaggtgtattttccatatatt |
48123932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University