View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16796_low_16 (Length: 399)
Name: NF16796_low_16
Description: NF16796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16796_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 13 - 159
Target Start/End: Complemental strand, 43008924 - 43008778
Alignment:
| Q |
13 |
agagatgaagatgagctaggaaatgataattaattaaggaatgcattattgaattgtgagtgctatccataggaaggagcacaagctatgcaagctagaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43008924 |
agagatgaagatgagctaggaaatgataattaattaaggaatgcattattgaattgtgagtgctatccataggaaggagcacaagctatgcaagctagaa |
43008825 |
T |
 |
| Q |
113 |
aaagaatggcagaagaaagaccatcctcttccacattggaactactc |
159 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43008824 |
aaagaattgcagaagaaagaccatcctcttccacattggaactactc |
43008778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 246 - 373
Target Start/End: Complemental strand, 43008691 - 43008564
Alignment:
| Q |
246 |
cttcttcattgcttcttctactttagacaccataatgttcttttgaatgatttgaagaaaaatgaaacaaaattagaaatttaagatgctagctatagat |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43008691 |
cttcttcattgcttcttctactttagacaccataatgttcttttgaatgatttgaagaacaatgaaacaaaattagaaatttaagatgctagctatagat |
43008592 |
T |
 |
| Q |
346 |
ggtattttgtgcttggatatccatacaa |
373 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
43008591 |
ggtatgttgtgcttggatatccatacaa |
43008564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University