View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16796_low_26 (Length: 305)
Name: NF16796_low_26
Description: NF16796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16796_low_26 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 305
Target Start/End: Original strand, 1182430 - 1182717
Alignment:
| Q |
18 |
cataactcactctcacaaacactatcccttttttaccctctagccggacgtgtccaagacgccaccaccattaactgcaccgacgatggcgttttcttcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1182430 |
cataactcactctcacaaacactatcccttttttaccctctagccggacgtgtccaagacgccaccaccattaactgcaccgacgatggcgttttcttca |
1182529 |
T |
 |
| Q |
118 |
tcgaatcacaaaccaccagcaatctctccgatatcctcacaaaccctaatttcaacacgcttgaatgcttcctcccaattacccaagaaaaacaaaacat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1182530 |
tcgaatcacaaaccaccagcaatctctccgatatcctcacaaaccctaatttcaacacgcttgaatgcttcctcccaactacccaagaaaaacaaaacat |
1182629 |
T |
 |
| Q |
218 |
gctcttagtaatccgtttcactttgttcagttgtggttccaccgcaattaccgtgtcccttacacataagatcgttgactttaacaca |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1182630 |
gctcttagtaatccgtttcactttgttcagttgtggttccaccgcaattaccgtgtcccttacacataagatcgttgactttaacaca |
1182717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University