View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16796_low_36 (Length: 231)
Name: NF16796_low_36
Description: NF16796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16796_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 208
Target Start/End: Original strand, 44526535 - 44526724
Alignment:
| Q |
19 |
gaaagctaactgaatttgtcaccagttacttccattcataaatggtgtttgccataataaaatgacctatatctatgctctatctaaccaataaatcatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44526535 |
gaaagctaactgaatttgtcaccagttacttccattcataaatggtgtttgccataataaaatgacctatatctatgctctatctaaccaataaatcatt |
44526634 |
T |
 |
| Q |
119 |
aattcatttcnnnnnnnattacaaaaacataatcaagtcgtcgttaacaacctaacagactaaaattagtttactttctcaaactatggt |
208 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44526635 |
aattcatttcttttcttattaaaaaaacataatcaagtcgtctttaacaacctaacagactaaaattagtttactttctcaaactatggt |
44526724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University