View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16796_low_42 (Length: 214)
Name: NF16796_low_42
Description: NF16796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16796_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 44959874 - 44960078
Alignment:
| Q |
1 |
atgaattgtctaaagaaaaacttgataacaaaatctactagtaaagtataccnnnnnnnn-gatccactaatataagagaaaggtgcatggaaacataaa |
99 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44959874 |
atgaattatctaaagaaaaacttgataacaaaatctactag-aaagtataccaaaaaaaaagatccactaatataagagaaaggtgcatggaaacataaa |
44959972 |
T |
|
| Q |
100 |
tcgcttt------ttctttttcataaatgtacatagtctacatttaatctactttaatttgctgaaaggtgtagttgtgtatcattatttttctcttttt |
193 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44959973 |
tcgctttttctttttctttttcataaatgtacataggctacatttaatctactttaatttgctgaaaggtgtagtggtgtatcattatttttctcttttt |
44960072 |
T |
|
| Q |
194 |
gaggag |
199 |
Q |
| |
|
| |||| |
|
|
| T |
44960073 |
ggggag |
44960078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University