View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16796_low_43 (Length: 212)

Name: NF16796_low_43
Description: NF16796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16796_low_43
NF16796_low_43
[»] chr4 (1 HSPs)
chr4 (32-212)||(43008901-43009077)


Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 32 - 212
Target Start/End: Complemental strand, 43009077 - 43008901
Alignment:
32 tttaaaggctatactataatttctaagaccatagtttatagacaagatgcaaattcgagagataattaagtgctgnnnnnnnnnnnnnnnnnnnccaaag 131  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                   ||||||    
43009077 tttaaaggctatactataatttctaagaccatagtttatagacaagatgcaaattcgagagataattaagtgctgaaaaaaaaaaaaaaa----ccaaag 43008982  T
132 agataattgaatgtaattaatctaattttctaattaatgagaggtgtgaagaagataagagatgaagatgagctaggaaat 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43008981 agataattgaatgtaattaatctaattttctaattaatgagaggtgtgaagaagataagagatgaagatgagctaggaaat 43008901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University