View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16797_high_25 (Length: 251)
Name: NF16797_high_25
Description: NF16797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16797_high_25 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 28 - 251
Target Start/End: Complemental strand, 24357442 - 24357219
Alignment:
| Q |
28 |
cgaatcacatttttaccattcacaaggctcgaaccgaaaccatgattaggggattcaagtcaagtttcactcagtgcaacataatgttggtaagttgttt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24357442 |
cgaatcacatttttaccattcacaaggctcgaaccgaaaccataattaggggattcaagtcaagtttcactcagtgcaacataatgttggtaagttgttt |
24357343 |
T |
 |
| Q |
128 |
attattataattaataagtaacaagaacaaagtaagaaagtaattacacttttgaaataaaccggcatccacgagagaagaacaaagtaaccctgcaaat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24357342 |
attattataattaataagtaacaagaacaaagtaagaaagtaattacacttttgaaataaaccggcatccacgagagaagaacaaagtaaccctgcaaat |
24357243 |
T |
 |
| Q |
228 |
taaacaaggtcaaaatcagtatgc |
251 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24357242 |
taaacaaggtcaaaatcagtatgc |
24357219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University