View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16797_high_4 (Length: 507)
Name: NF16797_high_4
Description: NF16797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16797_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 471; Significance: 0; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 471; E-Value: 0
Query Start/End: Original strand, 1 - 487
Target Start/End: Original strand, 21815014 - 21815500
Alignment:
| Q |
1 |
gaaaattgcgttcaattgttaggtgatattggttcagaacattttatgggtctaattggtgttgatgccacaacactgtttactcccccttcagggtctt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21815014 |
gaaaattgctttcaattgttaggtgatattggttcagaacattttatgggtctaattggtgttgatgccacaacactgtttactcccccttcagggtctt |
21815113 |
T |
 |
| Q |
101 |
ccctagtaaaagctgtggcttctagggaaatttcacgtttgaaccctatttgggtccatgcaaggactacagagaagccattttatgccatactgcatag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21815114 |
ccctagtaaaagctgtggcttctagggaaatttcacgtttgaaccctatttgggtccgtgcaaggactacagagaagccattttatgccatactgcatag |
21815213 |
T |
 |
| Q |
201 |
gattgatgttggggttttgattgatttggagcctgcaaggtctagtggtcctgccttgtcactctcggggacatttcaatcacagaagatggctgttagt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21815214 |
gattgatgttggggttttgattgatttggagcctgcaaggtctagtggtcctgccttgtcactctcggggtcatttcaatcacagaagatggctgttagt |
21815313 |
T |
 |
| Q |
301 |
gcaatttcaaggctgcaatcttgtcgtcgggaagacattagtttgttgtgtgatactgttgttgaggaagttcaaaagcttactggatatgaaagggtta |
400 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21815314 |
gcaatttcgaggctgcaatcttgtcgtcgggaagacattagtttgttgtgtgatactgttgttgaggaagttcaaaagcttactggatatgaaagggtta |
21815413 |
T |
 |
| Q |
401 |
tgatttataagtttcatgaggatgatcacggtgaggttgtatctgagaccaggaggtctgatttagagtcttatttggggttgcatt |
487 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21815414 |
tgatttataagtttcatgaggatgatcacggtgaggttgtatctgagaccaggaggtctgatttagagtcttatttggggttgcatt |
21815500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 12992753 - 12992695
Alignment:
| Q |
382 |
actggatatgaaagggttatgatttataagtttcatgaggatgatcacggtgaggttgt |
440 |
Q |
| |
|
||||| ||||| ||||||||| |||||||||||||||||||||| || ||||||||||| |
|
|
| T |
12992753 |
actggttatgatagggttatggtttataagtttcatgaggatgagcatggtgaggttgt |
12992695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 174 - 239
Target Start/End: Complemental strand, 12992961 - 12992896
Alignment:
| Q |
174 |
gaagccattttatgccatactgcataggattgatgttggggttttgattgatttggagcctgcaag |
239 |
Q |
| |
|
|||||| ||||||| || || ||||||||||||||||| ||| | ||||||||||| |||||||| |
|
|
| T |
12992961 |
gaagcctttttatggtattcttcataggattgatgttggtgttgttattgatttggaacctgcaag |
12992896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University