View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16797_low_16 (Length: 370)
Name: NF16797_low_16
Description: NF16797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16797_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 14 - 352
Target Start/End: Original strand, 33727946 - 33728283
Alignment:
| Q |
14 |
atcaatcatgtgatttagttcaaccaatgacccaccaattcaatgctttcaccagattaatttatcagtttgggtttttaaaatagattgcttttttgaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33727946 |
atcaatcatgtgatttagttcaaccaatgacccaccaattcaatgctttcaccagattaatttatcagtttgggtttttaaaatagattggttttttgaa |
33728045 |
T |
 |
| Q |
114 |
ataggtggaaccttttattattatccagccaaatttccaaaaacagccatcatcaaagtttaaacactggcattttgagggtattatcgggatttcttgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
33728046 |
ataggtggaaccttttattattatccagccaaatttccaaaa-cagccatcatcaaagtttaaagactggcattttgagggtattatcgggatttctcgg |
33728144 |
T |
 |
| Q |
214 |
taattaaaaataaaccaagtttaaacattagtcattagggcttaatacttcgcgtttcttctcgcgcgctctctcactctgtccctcaccgcctttcatc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33728145 |
taattaaaaataaaccaagtttaaacattagtcattagggcttaatacttctcgtttcttctcgcgcgctctctcactctgtccctcaccgcctttcatc |
33728244 |
T |
 |
| Q |
314 |
tcaaacttccgctgcaattccatctccggcgatcctggt |
352 |
Q |
| |
|
|||||||||||| |||||||||||||| | ||||||||| |
|
|
| T |
33728245 |
tcaaacttccgccgcaattccatctccagtgatcctggt |
33728283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University