View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16797_low_25 (Length: 255)
Name: NF16797_low_25
Description: NF16797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16797_low_25 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 62 - 255
Target Start/End: Complemental strand, 50074304 - 50074111
Alignment:
| Q |
62 |
atctttgtatgcatgcaaatttgaatcctttnnnnnnngaattagtatttatataaaacaatctctgtatgcatatgcaatcttannnnnnnaaggaaat |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
50074304 |
atctttgtatgcatgcaaatttgaatcctttaaaaaaagaattagtatttatataaaacaatctccgtatgcatatgcaatcttatttttttaaggaaat |
50074205 |
T |
 |
| Q |
162 |
tgtatgcaggcaaatgtttatgatgatcatattagtataaaataacatatttaagcaacattttcttgccctagtttatctaacctccgtagat |
255 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50074204 |
tgtatgcacgcaaatgtttatgatgatcatattagtataaaataacatatttaagcaacattttcttgccctagtttatctaacctccgtagat |
50074111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 14 - 63
Target Start/End: Complemental strand, 50074902 - 50074853
Alignment:
| Q |
14 |
gagatgaagttgaaattcatatttaagtaaagtaattttataaaacttat |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50074902 |
gagatgaagttgaaattcatatttaagtaaagtaattttataaaacttat |
50074853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 14 - 63
Target Start/End: Complemental strand, 50068883 - 50068834
Alignment:
| Q |
14 |
gagatgaagttgaaattcatatttaagtaaagtaattttataaaacttat |
63 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
50068883 |
gagatgaagttgaaagtcatatttaagtaaagtaattttataaaatttat |
50068834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University