View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16797_low_28 (Length: 249)
Name: NF16797_low_28
Description: NF16797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16797_low_28 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 11 - 249
Target Start/End: Complemental strand, 43164223 - 43163985
Alignment:
| Q |
11 |
atgaagatttctatccttcacaagagtgacctcaaaaacagttaatggcaacctttcagtcactcacaaatagcttgttgtctaattttcaaacccttta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43164223 |
atgaagatttctatccttcacaagagtgacctcaaaaacagttaatggcaacctttcagtcactcacaaatagccagttgtctaattttcaaacccttta |
43164124 |
T |
 |
| Q |
111 |
cattttgtttttaggtttctaatgcattgactaaattatcatcaacgactattagttattttctcatgttttaaatattcttcataacagatatacatgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164123 |
cattttgtttttaggtttctaatgcattgactaaattatcatcaacgactattagttattttctcatgttttaaatattcttcataacagatatacatgt |
43164024 |
T |
 |
| Q |
211 |
gtcttcataacaaattaaaacaaactaactagaccaaac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164023 |
gtcttcataacaaattaaaacaaactaactagaccaaac |
43163985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University