View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16798_high_28 (Length: 365)
Name: NF16798_high_28
Description: NF16798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16798_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 40243597 - 40243822
Alignment:
| Q |
18 |
tgattgatggaagaaaccccttcatttataacagctctatgctttctcatgtgtcctcctaatgcttgacccaaagagaatcccataccacaaatagaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40243597 |
tgattgatggaagaaaccccttcatttataacagctctatgttttctcatgtgtcctcctaatgcttgacccaaagagaatcccataccacaaatagaac |
40243696 |
T |
|
| Q |
118 |
actcatgcatttttggtttgttccacaaactaagagattttgcttgttctttgagttcttcaccttcagctagtttcattctcttgtggctagccctatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40243697 |
actcatgcatttttggtttgttccacaaactaagagattttgcttgttctttgagttcttcaccttcagctagtttcattctcttgtggctagccctatg |
40243796 |
T |
|
| Q |
218 |
gccaccaagggcttgaaaagatgaga |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40243797 |
gccaccaagggcttgaaaagatgaga |
40243822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 300 - 355
Target Start/End: Original strand, 40243879 - 40243934
Alignment:
| Q |
300 |
ggacaagatagtagcatcaaacaatttgcataatctatgccttcattgctcctttg |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40243879 |
ggacaagatagtagcatcaaacaatttgcataatctatgccttcattgctcctttg |
40243934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 27 - 91
Target Start/End: Original strand, 40237963 - 40238027
Alignment:
| Q |
27 |
gaagaaaccccttcatttataacagctctatgctttctcatgtgtcctcctaatgcttgacccaa |
91 |
Q |
| |
|
||||||||| |||| || |||| |||| ||||| ||||||||||||| || |||||||| ||||| |
|
|
| T |
40237963 |
gaagaaacctcttcgttcataatagctttatgccttctcatgtgtccacccaatgcttgccccaa |
40238027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University