View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16798_high_38 (Length: 313)
Name: NF16798_high_38
Description: NF16798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16798_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 55 - 304
Target Start/End: Original strand, 42018081 - 42018329
Alignment:
| Q |
55 |
agctgctgccaagaaaacggaaactcttccattttgtcagagtcaggtgtcagtggatgagagaatgagctccgatgtcatcgagactgaagcaaagctt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42018081 |
agctgctgccaagaaaacggaaactcttcc-ttttgtcagagtcaggtgtcagtggatgagagaatgagctccgatgtcatcgagactgaagcaaagctt |
42018179 |
T |
 |
| Q |
155 |
tcagctgataataataagagcagcaaggcggcggtttctcgaatcaacagcgggaaaggagcttcatgcaggtctcgttctatgacatcatggcttgacg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42018180 |
tcagctgataataataagagcagcaaggcggcggtttctcgaatcaacagcgggaaaggagcttcatgcaggtctcgttctatgacatcatggcttgacg |
42018279 |
T |
 |
| Q |
255 |
gctgggatcaagaagatacttatgctgctcttgctgttgtctgtgctgct |
304 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42018280 |
gctgggaacaagaagatacttatgctgctcttgctgttgtctgtgctgct |
42018329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 51 - 304
Target Start/End: Original strand, 1251297 - 1251549
Alignment:
| Q |
51 |
agtcagctgctgccaagaaaacggaaactcttccattttgtcagagtcaggtgtcagtggatgagagaatgagctccgatgtcatcgagactgaagcaaa |
150 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251297 |
agtcagctgctgccaagaaaacggaaactattcc-ttttgtcagagtcaggtgtcagtggatgagagaatgagctccgatgtcatcgagactgaagcaaa |
1251395 |
T |
 |
| Q |
151 |
gctttcagctgataataataagagcagcaaggcggcggtttctcgaatcaacagcgggaaaggagcttcatgcaggtctcgttctatgacatcatggctt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251396 |
gctttcagctgataataataagagcagcaaggcgtcggtttctcgaatcaacagcgggaaaggagcttcatgcaggtctcgttctatgacatcatggctt |
1251495 |
T |
 |
| Q |
251 |
gacggctgggatcaagaagatacttatgctgctcttgctgttgtctgtgctgct |
304 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251496 |
gacggctgggaacaagaagatacttatgctgctcttgctgttgtctgtgctgct |
1251549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University