View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16798_high_43 (Length: 268)
Name: NF16798_high_43
Description: NF16798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16798_high_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 5e-31; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 186 - 258
Target Start/End: Original strand, 31423694 - 31423766
Alignment:
| Q |
186 |
agagagggtgccgtcagcgggaacaacagagatggtggtgcaaggtggttgttggtgtggctggtgatgatgt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31423694 |
agagagggtgccgtcagcgggaacaacagagatggtggtgcaaggtggttgttggtatggctggtgatgatgt |
31423766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 31423573 - 31423628
Alignment:
| Q |
65 |
tcacggttgttttgttgttcacagattttgaggtggttgctgagtttgaatgttga |
120 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31423573 |
tcacggttgtgttgttgttcacggattttgaggtggttgctgagtttgaatgttga |
31423628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 31426842 - 31426802
Alignment:
| Q |
1 |
aagcaactttgaattcttctgtgaggatgcttttgctcttt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31426842 |
aagcaactttgaattcttctgtgaggatgcttttgctcttt |
31426802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 7171803 - 7171763
Alignment:
| Q |
1 |
aagcaactttgaattcttctgtgaggatgcttttgctcttt |
41 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7171803 |
aagcaactttgaattcttctgtgatgatgcttttgctcttt |
7171763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University