View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16798_high_48 (Length: 257)
Name: NF16798_high_48
Description: NF16798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16798_high_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 28 - 204
Target Start/End: Original strand, 36358028 - 36358204
Alignment:
| Q |
28 |
aaatgaaaagacatggtacttggggcttcccaacaacacaatatgttgcacttgagaagaagaaaaacaccatccataacttagtcttatgatccatatc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36358028 |
aaatgaaaagacatggtacttggggcttcccaacaacacaatatgttgcacttgagaagaagaaaaacaccatccataacttagtcttatgatccatatc |
36358127 |
T |
 |
| Q |
128 |
nnnnnnnnnnnntgtcaaaagtttgttctgatccaaaatatttggaatccaagcacaagatttgcaggtgtagctaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36358128 |
aaaaagaaaaaatgtcaaaagtttgttctgatccaaaatatttggaatccaagcacaagatttgcaggtgtagctaa |
36358204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University