View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16798_low_36 (Length: 332)
Name: NF16798_low_36
Description: NF16798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16798_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 69 - 311
Target Start/End: Complemental strand, 38924057 - 38923814
Alignment:
| Q |
69 |
ttgtgatggtgaggaggtggaaaatccttgtaggggtgtagatagcaatatagttgaagaagaactctttggattttttctgccaatccattttgtgtag |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38924057 |
ttgtgatggtgaggaggtggaaaatccttgtaggggtgtagatagcaatatagttgaagaagaactctttggattttttctgccaatccattttgtgtag |
38923958 |
T |
|
| Q |
169 |
aatgaaaccaattagtgttgaattgaagaaacacgttgttctttatttacaagctaagggaagttcaagattaagtaaaggtgtttctttatgtatgtga |
268 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38923957 |
aatgaaaacaattagtgttgaattgaagaaacacgttgttctttatttacaagctaagggaagttcaagattaagtaaaggtgtttctttatgtatgtga |
38923858 |
T |
|
| Q |
269 |
cttgacaactattttttatg-aatgaaatttagtaagtggttac |
311 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
38923857 |
cttgacaactattttttatgaaatgaaatttaataagtggttac |
38923814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University