View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16798_low_50 (Length: 260)
Name: NF16798_low_50
Description: NF16798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16798_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 38924085 - 38924335
Alignment:
| Q |
1 |
ttcttctcttagctagtctctctggtgcaaaattctaccttcaaattcattcacaacaacccttaccttatcttttctcttttgctatacacacctcccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38924085 |
ttcttctcttagctagtctctctggtgcaaaattctaccttcaaattcattcacaacaacccttaccttatcttttctcttttgctatacacacctcccc |
38924184 |
T |
|
| Q |
101 |
atgtattctctacgttcttgtctccattgtaagtgtagctactttgatcaatggtttgatgggaaaaatcaaccttatgaatgattcatccaattctatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38924185 |
atgtattctctacgttcttgtctccattgtaagtgtagctactttgatcaatggtttgatgggaaaaatcaaccttatgaatgattcatccaattctatt |
38924284 |
T |
|
| Q |
201 |
cttctccaaactcgtctttacatgtcatggaaatggattcttcttctcact |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38924285 |
cttctccaaactcgtctttacatgtcatggaaatggattcttcttttcact |
38924335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University