View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16798_low_51 (Length: 258)
Name: NF16798_low_51
Description: NF16798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16798_low_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 32 - 239
Target Start/End: Complemental strand, 26897596 - 26897389
Alignment:
| Q |
32 |
ataatactaaggtgtaaactgatgtatcatgaagttaatctgtatggtataatttccaatctaaaatgaactggtcatataatatcataatctttttggt |
131 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26897596 |
ataatactatggtgtaaactgatgtatcatgaagttaatctgtatggtataatttcctatctaaaatgaactggtcatatgatatcataatctttttggt |
26897497 |
T |
 |
| Q |
132 |
aagcaaacgcatttgttgatgatgctcttgttgtttatggtagggagttggtggcattgttgaattggcgcctggttacttgcctgctgcctatgatagt |
231 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26897496 |
aagcaaacacatttgttgatgatgctcttgttgtttatgatagggagttggtggcattgttgaattggcgcctggttacttgcctgctgcctatgatagt |
26897397 |
T |
 |
| Q |
232 |
gttaaaaa |
239 |
Q |
| |
|
|||||||| |
|
|
| T |
26897396 |
gttaaaaa |
26897389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University