View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16799_high_12 (Length: 243)
Name: NF16799_high_12
Description: NF16799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16799_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 23 - 224
Target Start/End: Original strand, 42661781 - 42661982
Alignment:
| Q |
23 |
tattgtatttcttggcttgggttgctcgattataatggcaactatcaagtacataattttgttgctggggattgtaacaccagatttatgtcaagagagt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661781 |
tattgtatttcttggcttgggttgctcgattataatggcaactatcaagtacataattttgttgctggggattgtaacaccagatttatgtcaagagagt |
42661880 |
T |
|
| Q |
123 |
tgttcttgcatgcatcgatttgaacaataatatgcattgtcattgacagaagaggagaaacaatacggttggtaaagctatgagtcacgttaatctacac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661881 |
tgttcttgcatgcatcgatttgaacaataatatgcattgtcattgacaaaagaggagaaacaatacggttggtaaagctatgagtcacgttaatctacac |
42661980 |
T |
|
| Q |
223 |
ac |
224 |
Q |
| |
|
|| |
|
|
| T |
42661981 |
ac |
42661982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University