View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16799_high_13 (Length: 240)
Name: NF16799_high_13
Description: NF16799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16799_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 218
Target Start/End: Complemental strand, 56020192 - 56019988
Alignment:
| Q |
14 |
tgaatcaaccgagagaatttatgcataaggttgaccctcttttgcaaggacacttccccaaccgaggtctgcgtcgtctgcttttaataattgatatgtg |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56020192 |
tgaatgaaccgagagaatttatgcataaggttgaccctcttttgcaaggacacttccccaaccgaggtctgcgtcgtctgcttttaataattgatatgtg |
56020093 |
T |
|
| Q |
114 |
tctccgggagaatccaagagaacgtccaaccattggtgaaattgttgatgcactaaaatacttatcttccaagagtacctctaaagtctataaacatggg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56020092 |
tctccgggagaatccaagagaacgtccaaccattggtgaaattgttgatgcactaaaatacttatcttccaagagtacctctaaagtctataaacatggg |
56019993 |
T |
|
| Q |
214 |
gtgcg |
218 |
Q |
| |
|
|||| |
|
|
| T |
56019992 |
ttgcg |
56019988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University