View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16800_low_4 (Length: 303)
Name: NF16800_low_4
Description: NF16800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16800_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 9 - 200
Target Start/End: Complemental strand, 32265788 - 32265594
Alignment:
| Q |
9 |
gatgaataagggaaatggcttaatgggttatcttggtttttacttttacatcattttttgaagcatcttcttctattgaggtacattgatgaatatcttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32265788 |
gatgaataagggaaatggcttaatgggttatcttggtttttacttttacatcattttttgaagcatcttcttctattgaggtacattgatgaatatcttg |
32265689 |
T |
 |
| Q |
109 |
aattttaagaatgnnnnnnnnnnnnnnnnngt---tggcattatcacatatgatgaaagcatttgcaatgtacagaaagccatgtgggttaatga |
200 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32265688 |
aattttaagaattgttttttttttctttttttttttggcattatcacatatgatgaaagcatttgcaatgtacagaaagccatgtgggttaatga |
32265594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University