View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16801_low_10 (Length: 243)
Name: NF16801_low_10
Description: NF16801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16801_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 48 - 226
Target Start/End: Original strand, 49265395 - 49265572
Alignment:
| Q |
48 |
tctagtgtagtagtagagtttattaagtgaggaacttacccattcaacaagactacgctctccttgaggtcgtgtattatcaagagccctacgtcctgaa |
147 |
Q |
| |
|
|||||||||||||| | || |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
49265395 |
tctagtgtagtagttta-ttaattaagcgaggaacttacccattcaacaagactacgctctccttgcggtcgtgtattatcaagagccctgcgtcctgaa |
49265493 |
T |
 |
| Q |
148 |
ataagttcgagcatgaccactccatagctatacacatcagattttatagttagttgtccggtcataagatattcagggg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49265494 |
ataagttcgagcatgaccactccatagctatacacatcagatttaatagttagttgtccggtcataagatattcagggg |
49265572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University