View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16801_low_12 (Length: 237)
Name: NF16801_low_12
Description: NF16801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16801_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 88 - 221
Target Start/End: Original strand, 5570383 - 5570516
Alignment:
| Q |
88 |
gtcactcacagatcgaagctctctgctatgtggatctgttagccaacgctggactcttaaacctagaaattccatttcactctccccaatttcacaccct |
187 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5570383 |
gtcactcacatatcgaagctctctgctatgtggatttgttagccaacgctggactcttaaacctagaaattccatttcactctccccaatttcacaccct |
5570482 |
T |
 |
| Q |
188 |
aatccttctcttgaactctttcccaccacacctc |
221 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
5570483 |
aatccttctctcgaactctttcccaccacacctc |
5570516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 5570292 - 5570355
Alignment:
| Q |
1 |
ttctcaatctgcagatcgccttatcactcactctgtcaaacgtctccctcgtcacaactcgaac |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5570292 |
ttctcaatctgcagatcgccttatcactcactctgtcaaacgtctccctcgtcacaacttgaac |
5570355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 166
Target Start/End: Original strand, 37056677 - 37056719
Alignment:
| Q |
124 |
tgttagccaacgctggactcttaaacctagaaattccatttca |
166 |
Q |
| |
|
||||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
37056677 |
tgttacccaacgctggactctaaaacctagaacttccatttca |
37056719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University