View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16801_low_9 (Length: 258)
Name: NF16801_low_9
Description: NF16801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16801_low_9 |
 | |
|
| [»] scaffold0010 (1 HSPs) |
| |
|
| [»] scaffold0049 (2 HSPs) |
| | |
|
| [»] chr1 (2 HSPs) |
| |
|
| [»] chr5 (2 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0010 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 101 - 258
Target Start/End: Original strand, 251284 - 251440
Alignment:
| Q |
101 |
gaagaagggttttctaagttaagagaggatggtttaaagagaagttgaaatgtgtaaatgagtgaagtgagagtggtttgggtctttggcagctggtgcn |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
251284 |
gaagaagggttttctaagttaagagaggatggtttaaagagaagttgaaatgtgtaaatgagtgaagtgagagtggtttgggtctttggcagctggtgc- |
251382 |
T |
|
| Q |
201 |
nnnnnnnnnnnnntgaggaggttcaacatgcaaaaaacatagggatatatgtgaaaaa |
258 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
251383 |
aaaaaaaaaaaaatgaagaggttcaacatgcaaaaaacatagggatatatgtgaaaaa |
251440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 101 - 199
Target Start/End: Original strand, 3695076 - 3695174
Alignment:
| Q |
101 |
gaagaagggttttctaagttaagagaggatggtttaaagagaagttgaaatgtgtaaatgagtgaagtgagagtggtttgggtctttggcagctggtgc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3695076 |
gaagaagggttttctaagttaagagaggatagtttagtgagaagttgaaatgtgtagatgagtgaagtgagagtggtttgggtctttggcagctggtgc |
3695174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 132 - 199
Target Start/End: Original strand, 39052590 - 39052657
Alignment:
| Q |
132 |
gtttaaagagaagttgaaatgtgtaaatgagtgaagtgagagtggtttgggtctttggcagctggtgc |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39052590 |
gtttagagagaagttgaaatgtgtaaatgagtgaagtgagagtggtttgggtctttggcagctggtgc |
39052657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 7e-21; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 101 - 184
Target Start/End: Original strand, 41501831 - 41501913
Alignment:
| Q |
101 |
gaagaagggttttctaagttaagagaggatggtttaaagagaagttgaaatgtgtaaatgagtgaagtgagagtggtttgggtc |
184 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||| ||||||||| ||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
41501831 |
gaagaagggttttctaagttaagagaagatagtttagagagaagttaaaatgtgtaaatgagtg-agtgatggtggtttgggtc |
41501913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 41501935 - 41501979
Alignment:
| Q |
214 |
tgaggaggttcaacatgcaaaaaacatagggatatatgtgaaaaa |
258 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
41501935 |
tgaggaggttcaaagtgctaaaaacatagggatatatgtgaaaaa |
41501979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 19140336 - 19140292
Alignment:
| Q |
214 |
tgaggaggttcaacatgcaaaaaacatagggatatatgtgaaaaa |
258 |
Q |
| |
|
|||| |||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
19140336 |
tgagcaggttcaaattgcaaaaaacataggggtatatgtgaaaaa |
19140292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 101 - 184
Target Start/End: Complemental strand, 45390 - 45308
Alignment:
| Q |
101 |
gaagaagggttttctaagttaagagaggatggtttaaagagaagttgaaatgtgtaaatgagtgaagtgagagtggtttgggtc |
184 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||| |||| | || ||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
45390 |
gaagaagggttttctaagttaagagaagatagtttagagagcatttaaaatgtgtaaatgagtg-agtgagggtggtttgggtc |
45308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 45286 - 45242
Alignment:
| Q |
214 |
tgaggaggttcaacatgcaaaaaacatagggatatatgtgaaaaa |
258 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
45286 |
tgaggaggttcaaagtgcaaaaaacataggggtatatgtgaaaaa |
45242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 48666041 - 48666085
Alignment:
| Q |
214 |
tgaggaggttcaacatgcaaaaaacatagggatatatgtgaaaaa |
258 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
48666041 |
tgaggaggttcaaaatgcaaaaacaatagggatatatgtgaaaaa |
48666085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 22580570 - 22580526
Alignment:
| Q |
214 |
tgaggaggttcaacatgcaaaaaacatagggatatatgtgaaaaa |
258 |
Q |
| |
|
|||| |||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
22580570 |
tgagcaggttcaaagtgcaaaaaacataggggtatatgtgaaaaa |
22580526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 29635599 - 29635555
Alignment:
| Q |
214 |
tgaggaggttcaacatgcaaaaaacatagggatatatgtgaaaaa |
258 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
29635599 |
tgaggaggttcaaagtgcaaaaaacataggggtatatatgaaaaa |
29635555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 184
Target Start/End: Complemental strand, 29635672 - 29635621
Alignment:
| Q |
132 |
gtttaaagagaagttgaaatgtgtaaatgagtgaagtgagagtggtttgggtc |
184 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
29635672 |
gtttagagagaagttaaaatgtgtaaatgagtg-agtgatggtggtttgggtc |
29635621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 678798 - 678842
Alignment:
| Q |
214 |
tgaggaggttcaacatgcaaaaaacatagggatatatgtgaaaaa |
258 |
Q |
| |
|
|||| |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
678798 |
tgagcaggttcaaagtgcaaaaaacataaggatatatgtgaaaaa |
678842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University