View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16802_low_5 (Length: 331)
Name: NF16802_low_5
Description: NF16802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16802_low_5 |
 | |
|
| [»] scaffold0376 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 6 - 313
Target Start/End: Original strand, 4021436 - 4021745
Alignment:
| Q |
6 |
aagatcatatataatgttaacctcctaaacttaaataaagatttaca--atgaattggggagagggtttggaaggaaataagattaattgggtgagttcg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4021436 |
aagatcatatataatgttaacctcctaaacttaaataaagatttacacaatgaattgaggagagggtttggaaggaaataagattaattgggtgagttgg |
4021535 |
T |
|
| Q |
104 |
gagaaggtgtgtcggtcaaaagaaggaggactcgaagtaaaaaacttgtacttatttcatttaacgttacgaagaaaatggttatggaggtgcattgcgg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4021536 |
gagaaggtgtgtcggtcaaaagaaggaggactcgaagtaaaaaacttgtacttatttcatttaaagttacgaagaaaatggttatggaggtgcattgcgg |
4021635 |
T |
|
| Q |
204 |
aaaatggtactatttggttcgggttaataaagtataggtacagtccagtttcaggaaaattgctccgtccagataccgtgtagtcgggaaggatagactc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4021636 |
aaaatggtactatttggttcaggttaataaagtataggtacagtccagtttcaggaaaattgctccatccagataccgtgtagtcgggaaggatagactc |
4021735 |
T |
|
| Q |
304 |
gttatggtgg |
313 |
Q |
| |
|
|||||||||| |
|
|
| T |
4021736 |
gttatggtgg |
4021745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0376 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 61 - 107
Target Start/End: Original strand, 4892 - 4938
Alignment:
| Q |
61 |
gggagagggtttggaaggaaataagattaattgggtgagttcggaga |
107 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
4892 |
gggagggggattggaaggaaacaagattaattgggtgagttgggaga |
4938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University