View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16803_high_13 (Length: 465)
Name: NF16803_high_13
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16803_high_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 428; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 428; E-Value: 0
Query Start/End: Original strand, 13 - 465
Target Start/End: Original strand, 32169486 - 32169940
Alignment:
| Q |
13 |
gaaacaagctttacaattataccctctcttctccaattcgtaacttccctcatggcattctcagcgaagacgggtcctctctctctccctcactttctga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169486 |
gaaacaagctttacaattataccctctcttctccaattcgtaacttccctcatggcattctcagcgaagacgggtcctctctctctccctcactttctga |
32169585 |
T |
 |
| Q |
113 |
tctgatatgatatcgttattattcatcgattcaagtatagaaacatttatgtaggattatttagggactagaatcaattggttcttaatcaagaattaag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169586 |
tctgatatgatatcgttattattcatcgattcaagtatagaaacatttatgtaggattatttaaggactagaatcaattggttcttaatcaagaattaag |
32169685 |
T |
 |
| Q |
213 |
gaaaggatttattctctatttaaatgtgattagtttgtagatactgtgctaattatgtggttgtcatataaagtttcatttt--tgtgtgtgtttgtagg |
310 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32169686 |
gaaaggatttattctccatttaaatgtgattagtttgtagatactgtgctaattatgtggttctcatataaagtttcatttttgtgtgtgtgtttgtagg |
32169785 |
T |
 |
| Q |
311 |
ttttacaaagtgtcagtgaaccagaccaccctttggtttcaggttggctccatcaggtcacgcttatttcttttatttctgatgtagtattttttcagct |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32169786 |
ttttacaaagtgtcagtgaaccagaccaccctttggtttcaggttggctccatcaggtcacgcttatttcttttatttctgatgtagtatttttttagct |
32169885 |
T |
 |
| Q |
411 |
tccaactatgaagcacatatacggacaccgaactcacacagacacgtcacgtcga |
465 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169886 |
tccaactatgaagcacatatacggacaccgaactcacacagacacgtcacgtcga |
32169940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University