View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16803_high_21 (Length: 365)
Name: NF16803_high_21
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16803_high_21 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 9e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 159 - 365
Target Start/End: Complemental strand, 29487688 - 29487482
Alignment:
| Q |
159 |
cttgaagagtagagagtcaaatctaaaataaggcgaacaatcacacatcacgtgcacaattcaacgcatctgcatgcgaacacgaaactaaattatagaa |
258 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||| || |
|
|
| T |
29487688 |
cttgaagggtagagagtcaaatccaaaataaggcgaacaatcacacgtcacgtgcacaattcaacgcatcaacatacgaacacgaaactaaattataaaa |
29487589 |
T |
|
| Q |
259 |
aaagagtatcatcgtgacaaccgataaatcgtcccgtccaccacaactctctgcttcataacacccgaaaacacccagcaacatagaccctttcgagcca |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29487588 |
aaagagtatcatcgtgacaaccgataaatcgacccgtccaccacaactctctgcttcataacacccgaaaacacccagcaacatagaccctttcgagtca |
29487489 |
T |
|
| Q |
359 |
taacagt |
365 |
Q |
| |
|
||||||| |
|
|
| T |
29487488 |
taacagt |
29487482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 70
Target Start/End: Complemental strand, 29487837 - 29487777
Alignment:
| Q |
10 |
catcatcatattcctagaaaatttaatcccaaccataaattttgtaaccaagaaacaaata |
70 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29487837 |
catcatcatattcctaaaaaatttaatcccgaccataaattttgtaaccaagaaacaaata |
29487777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University