View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16803_high_23 (Length: 356)
Name: NF16803_high_23
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16803_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 19 - 181
Target Start/End: Original strand, 44767503 - 44767665
Alignment:
| Q |
19 |
cttctcctattcaaataagtggtattttagtacatacattccgtttttgtattatgttttgtttgtgatttcgtcgtttaagtgatacaatgttgttgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
44767503 |
cttctcctattcaaataagtggtattttagtacatagattccgtttttgtattatgttttgtttgtgatttcgtcgtttgagtgataaaatgttgttgtt |
44767602 |
T |
|
| Q |
119 |
cgcgttttggtacgtagttttgatttctcatcttattgttatgttcgtttcattcagattgac |
181 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44767603 |
cgcgttttggtgtgtagttttgatttctcatcttattgttatgttcgtttcattcagattgac |
44767665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 213 - 262
Target Start/End: Original strand, 44767741 - 44767790
Alignment:
| Q |
213 |
atggtattccgaacacctttattttgtcacatttgtatgcattttgtcac |
262 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
44767741 |
atggtattccgaatgcctttattttgtcacatttgtaaacattttgtcac |
44767790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University