View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16803_high_38 (Length: 296)
Name: NF16803_high_38
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16803_high_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 283
Target Start/End: Complemental strand, 33865741 - 33865475
Alignment:
| Q |
17 |
caccaatagtgacggtttcaacaaatgatggtactggtgcaaaagatagtgaagtagatactattctaccaattaatgatgatggagattgtgctgcaaa |
116 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||||| | |
|
|
| T |
33865741 |
caccaatagtaactgtttcaacaaatgatggtaatgttgcaaaagatagtgaagtagatactattctaccaattaatggtgatggtgatagtgctgcaca |
33865642 |
T |
|
| Q |
117 |
accatatcttgaaaattcaacactgtcttccatgtggtgggagagtttgttgaacgtgagcaatgacaaaattggatcatgctctttactattaccagag |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33865641 |
accatatcttgaaaatccaacactgtcttccatgtggtgggagagtttgttgaacgtgagcaatgacaaaattggatcatgctctttactattaccagag |
33865542 |
T |
|
| Q |
217 |
gaatattccaaattaaatgttgagaactttcttgctgaaggacccagtactgtcggtgatttctcct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33865541 |
gaatattccaaattaaatgttgagaactttcttgctgaaggacccagtactgtcggtgatttctcct |
33865475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University