View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16803_high_40 (Length: 279)
Name: NF16803_high_40
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16803_high_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 48 - 179
Target Start/End: Original strand, 29443294 - 29443425
Alignment:
| Q |
48 |
aatagtattagagaaaaccatactatataataacttcactatcttctccaggagcttgacctgtgctggaaccatcatagttccacttgggaagctgtga |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29443294 |
aatagtattagagaaaaccatactatataataacttcactatcttctccaggagcttgacctgtgctggaaccatcatagttccacttgggaagctgtga |
29443393 |
T |
|
| Q |
148 |
agggtcagtaactggtcctgggagagtctgca |
179 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
29443394 |
agggtcagtaactggtcctggtagagtctgca |
29443425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 80 - 176
Target Start/End: Original strand, 33278426 - 33278522
Alignment:
| Q |
80 |
acttcactatcttctccaggagcttgacctgtgctggaaccatcatagttccacttgggaagctgtgaagggtcagtaactggtcctgggagagtct |
176 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||| ||||| |||||||||| |
|
|
| T |
33278426 |
acttcactatcatctccagaagcttgaccagtgctggaaccatcatagttccacttgggaagctttgaagggtcttcaacaggtccagggagagtct |
33278522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 66 - 177
Target Start/End: Original strand, 26250404 - 26250515
Alignment:
| Q |
66 |
catactatataataacttcactatcttctccaggagcttgacctgtgctggaaccatcatagttccacttgggaagctgtgaagggtcagtaactggtcc |
165 |
Q |
| |
|
||||||||| |||||||||||||||| ||| ||||||||| |||||| || |||||||||||||| || ||||| | |||||||||| | ||||| || |
|
|
| T |
26250404 |
catactataagataacttcactatcttgtcctggagcttgatttgtgcttgatccatcatagttccatttaggaagttttgaagggtcactcactggacc |
26250503 |
T |
|
| Q |
166 |
tgggagagtctg |
177 |
Q |
| |
|
|| |||||||| |
|
|
| T |
26250504 |
aggtagagtctg |
26250515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 80 - 143
Target Start/End: Original strand, 7204919 - 7204982
Alignment:
| Q |
80 |
acttcactatcttctccaggagcttgacctgtgctggaaccatcatagttccacttgggaagct |
143 |
Q |
| |
|
|||||||||||||| ||||| ||||| || ||||| |||||||| ||||||||||| ||||||| |
|
|
| T |
7204919 |
acttcactatcttcaccaggggcttgtccagtgctagaaccatcgtagttccacttaggaagct |
7204982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 80 - 143
Target Start/End: Original strand, 7193576 - 7193639
Alignment:
| Q |
80 |
acttcactatcttctccaggagcttgacctgtgctggaaccatcatagttccacttgggaagct |
143 |
Q |
| |
|
|||||| ||||||| ||||| ||||| || ||||| || ||||||||||||||||| ||||||| |
|
|
| T |
7193576 |
acttcagtatcttcaccaggggcttgtccagtgctagatccatcatagttccacttaggaagct |
7193639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University