View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16803_high_62 (Length: 215)

Name: NF16803_high_62
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16803_high_62
NF16803_high_62
[»] chr1 (1 HSPs)
chr1 (18-198)||(46249125-46249305)


Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 46249125 - 46249305
Alignment:
18 aaatcacaaccttgaagaatgatatcaaaagtcatagcctgaataggaaacaatgactcaattcccttttccttcaacttttctctcaacggctccgata 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46249125 aaatcacaaccttgaagaatgatatcaaaagtcatagcctgaataggaaacaatgactcaattcccttttccttcaacttttctctcaacggctccgata 46249224  T
118 tcttaaatttagaaatcccattgggatcctccaccttgttttccattactacaaattcttcttcagactttgcttttttct 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46249225 tcttaaatttagaaatcccattgggatcctccaccttgttttccattactacaaattcttcttcagactttgcttttttct 46249305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University