View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16803_low_39 (Length: 294)
Name: NF16803_low_39
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16803_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 48 - 278
Target Start/End: Complemental strand, 32725705 - 32725475
Alignment:
| Q |
48 |
ttgtggaaaggttcatggactcacttcatcattattcagcggtttttgattcattggaggctggttttccgatgcagaaccgggcccggactttggtgga |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725705 |
ttgtggaaaggttcatggactcacttcatcattattcagcggtttttgattcattggaggctggttttccgatgcagaaccgggcccggactttggtgga |
32725606 |
T |
|
| Q |
148 |
gagggtattttttgggcctagaattgcaggctcgttgggccggatatatagaacgggtggtgaagaggagagaaggtcatggggggagtggttaggtgag |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725605 |
gagggtattttttgggcctagaattgcaggctcgttgggccggatatatagaacgggtggtgaagaggagagaaggtcatggggggagtggttaggtgag |
32725506 |
T |
|
| Q |
248 |
gtagggtttaggggagttccggtgagctttg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32725505 |
gtagggtttaggggagttccggtgagctttg |
32725475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University