View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16803_low_44 (Length: 274)
Name: NF16803_low_44
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16803_low_44 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 12 - 274
Target Start/End: Original strand, 1805322 - 1805584
Alignment:
| Q |
12 |
aatacttatgcattctctgcttttcatgattagttagtcagtctgctgactgctgagttatgttggcatttgtacatttattttgcttattgttattaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1805322 |
aatacttatgcattctctgcttttcatgattagttagtcagtctgctgactgctgagttatgttggcatttgtacatttattttgcttattgttattaag |
1805421 |
T |
 |
| Q |
112 |
agtcttcgttcttatacaggtatgcattgctaggaaacagtttaagcatagctgttgttgcttccttacttcagtatcttttcaccgaagcttagtgatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1805422 |
agtcttcgttcttatacaggtatgcattgctaggaaacagtttaagcatagctgttgttgcttccttacttcagtatcttttcaccgaagcttagtgatt |
1805521 |
T |
 |
| Q |
212 |
tttcaatcgcaatatttactcaacagaagcagaaagtttctacccgtgcgtatcatgcaacga |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1805522 |
tttcaatcgcaatatttactcaacagaagcagaaagtttctacccgtgcgtatcatgcaacga |
1805584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University