View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16803_low_45 (Length: 271)
Name: NF16803_low_45
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16803_low_45 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 11 - 271
Target Start/End: Complemental strand, 41547938 - 41547679
Alignment:
| Q |
11 |
tctcattcttcttcatcgttagcttcagtataggatatatatcttagtttgtcacttatctgcacaagtttcgacttgctttgactttttgttgtcgtga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
41547938 |
tctcattcttcttcatcgttagcttcagtataggatatatatcttagtttgtcacttatatgcacaagtttcaacttgctttgactttt-gttgtcgtga |
41547840 |
T |
 |
| Q |
111 |
tatttgtcatcaaaccttacatattttaattcttcaacactcaatgnnnnnnnattgtacactatgcaagttatagagcattgagagtattccagaaaga |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41547839 |
tatttgtcatcaaaccttacatgttttaattcttcaacactcaatgtttttttattctacactatgcaagttatagagcattgagagtattccagaaaga |
41547740 |
T |
 |
| Q |
211 |
tgcgcttttgagaatttgaatcaaacttgttaaggttgtcttttggtgtttaacatacaca |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41547739 |
tgcgcttttgagaatttgaatcaaacttgttaaggttgtcttttggtgtttaacatacaca |
41547679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University