View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16803_low_49 (Length: 258)
Name: NF16803_low_49
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16803_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 22758467 - 22758245
Alignment:
| Q |
20 |
gacgtggttgacctgaatagaaaggacagtcttagaatttggtctgagcctgactcgaccctacaaaaccgacttataaggtaagggatgtctcttatcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22758467 |
gacgtggttgacctgaatagaaaggaaagtcttagaatttggtctgagcctgactcgaccctacaaaaccgacttataaggtaagggatgtctcttatcc |
22758368 |
T |
 |
| Q |
120 |
cactataaacaaattttcaggccttatctaatgtggg-cttcttgacaaaaacacattcaagagaaaacattaggccactagaagtggtttaacaaaaag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22758367 |
cactataaacaaattttcaggccttatctaatgtgggacttcttgacaaaaacacattcaagagaaaacattaggccactagaagtggtttaacaaaaag |
22758268 |
T |
 |
| Q |
219 |
acgagtgaaaacttttgatgtca |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
22758267 |
acgagtgaaaacttttgatgtca |
22758245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University