View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16803_low_56 (Length: 249)
Name: NF16803_low_56
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16803_low_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 32 - 234
Target Start/End: Complemental strand, 38592794 - 38592592
Alignment:
| Q |
32 |
gaagtattagacgataaaataaaatgtattctatacttcnnnnnnngtacaatatttcatgttatctttattaaaggaatcatcaaattaaatctatata |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38592794 |
gaagtattagacgataaaataaaatgtattctatacttctttttttgtacaatatttcatgttatctttattaaaggaatcatcaaattaaatctatata |
38592695 |
T |
 |
| Q |
132 |
tcaagactcaatttcatgttattttatttatatatatgtcgatcaatcaaaccatagcatgatacttttatatcatgtaggaaaaatgattttattgccg |
231 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38592694 |
tcaagactcaatttcatgtcattttatttatatatatgtcgatcaatcaaaccatagcatgatacttttatttcatgtaggaaaaatgattttattgccg |
38592595 |
T |
 |
| Q |
232 |
tgt |
234 |
Q |
| |
|
||| |
|
|
| T |
38592594 |
tgt |
38592592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University