View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16803_low_67 (Length: 203)
Name: NF16803_low_67
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16803_low_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 5 - 188
Target Start/End: Original strand, 48081121 - 48081304
Alignment:
| Q |
5 |
aaggcctgtaaagagcttctgtagcatccgaaaacatgtgaacgaggcctgtagcgagaattacaccggcagcgagggcttttgcagcgacgaagaggtt |
104 |
Q |
| |
|
|||| |||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48081121 |
aaggactgttaagagcttctgtagcatccgataacatgtgaacgaagcctgtagcgagaattacaccggcagcgaaggcttttgcagcgacgaagaggtt |
48081220 |
T |
|
| Q |
105 |
tccgtcggtgcgaaggtatcggcgatgttttccgatgagagggattgcgattcccgccattccggctaagaggattgatgccat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48081221 |
tccgtcggtgcgaaggtatcggcgatgttttccgatgagagggattgcgattcccgccattccggctaagaggattgatgccat |
48081304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University