View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16804_high_22 (Length: 274)
Name: NF16804_high_22
Description: NF16804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16804_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 17 - 264
Target Start/End: Original strand, 13790751 - 13791002
Alignment:
| Q |
17 |
aaaatcttgcaaaaacaaaccagctacttcataattacaattggtaaaagaaaattaacaattagtacatcatgatatcaagtcattggcattactgtag |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13790751 |
aaaatcttgcaaaaacaaacaagctacttcataattacaattgctaaaagaaaattaacaattagtacatcatgatatcaagtcattggcattactgtag |
13790850 |
T |
 |
| Q |
117 |
tgaaattaataatcaagaataaagataacatatcctttgac----atataaataatgatctcatcattcacttaatgtacatcaattatatgaattcatg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13790851 |
tgaaattaataatcaagaataaagataacatatcctttgacatatatataaataatgatctcatcattcacttaatgtacatcaattatatgaattcatg |
13790950 |
T |
 |
| Q |
213 |
gcctaacttttttgaaattgaaacaactcaaccccttcaaattcagtctctg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13790951 |
gcctaacttttttgaaattgaaacaactcaaccccttcagattcagtctctg |
13791002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University