View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16804_high_30 (Length: 240)
Name: NF16804_high_30
Description: NF16804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16804_high_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 225
Target Start/End: Complemental strand, 19352718 - 19352507
Alignment:
| Q |
20 |
gacctatcctatcgctcatcttcaatatgtgtagcagtgtgtgcgtgtctttcaccattagatgtggtcccatgctaagtagccatattg------gcaa |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
19352718 |
gacccatcctatcgctcatcttcaatatgtgtagcagtgtgtgcgtgtctttcaccattagatgtggtcccatgctaactagccatattgttaaaggcaa |
19352619 |
T |
 |
| Q |
114 |
aatttgatcccatgtttatctccttatcaacctctctaccaataaaaactttaccttagattaatgtttgaacattttgccttattatcgttaacagaat |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19352618 |
aatttgatcccatgtttatttccttatcaacctctctaccaataaaaaccttaccttagattaatgtttgaacatttttccttattatcgttaacagaat |
19352519 |
T |
 |
| Q |
214 |
tttaaccttctt |
225 |
Q |
| |
|
||| |||||||| |
|
|
| T |
19352518 |
tttcaccttctt |
19352507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University