View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16804_high_31 (Length: 230)

Name: NF16804_high_31
Description: NF16804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16804_high_31
NF16804_high_31
[»] chr5 (2 HSPs)
chr5 (1-163)||(14489963-14490125)
chr5 (178-224)||(14489835-14489881)


Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 14490125 - 14489963
Alignment:
1 ctgcatatgtgcttgtattgatccgtctggttgcatgatttttacttaattatctaataaactttacaaaaaagtgatgacttcattccatgagtcgttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
14490125 ctgcatatgtgcttgtattgatccgtctggttgcatgatttttacttaattatctaataaaatttacaaaaaagtgatgacttcattccatgagtcgttc 14490026  T
101 atagcttttagtgacaaatagtttcgcagaaaaaatctagcatgtcctctatgtatactttca 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14490025 atagcttttagtgacaaatagtttcgcagaaaaaatctagcatgtcctctatgtatactttca 14489963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 14489881 - 14489835
Alignment:
178 tagtaatttaaaattgtaatgaccttgtgaaagattagaattgaaat 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
14489881 tagtaatttaaaattgtaatgaccttgtgaaagattagaattgaaat 14489835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University