View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16804_high_31 (Length: 230)
Name: NF16804_high_31
Description: NF16804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16804_high_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 14490125 - 14489963
Alignment:
| Q |
1 |
ctgcatatgtgcttgtattgatccgtctggttgcatgatttttacttaattatctaataaactttacaaaaaagtgatgacttcattccatgagtcgttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14490125 |
ctgcatatgtgcttgtattgatccgtctggttgcatgatttttacttaattatctaataaaatttacaaaaaagtgatgacttcattccatgagtcgttc |
14490026 |
T |
 |
| Q |
101 |
atagcttttagtgacaaatagtttcgcagaaaaaatctagcatgtcctctatgtatactttca |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14490025 |
atagcttttagtgacaaatagtttcgcagaaaaaatctagcatgtcctctatgtatactttca |
14489963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 14489881 - 14489835
Alignment:
| Q |
178 |
tagtaatttaaaattgtaatgaccttgtgaaagattagaattgaaat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14489881 |
tagtaatttaaaattgtaatgaccttgtgaaagattagaattgaaat |
14489835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University