View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16804_low_15 (Length: 346)
Name: NF16804_low_15
Description: NF16804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16804_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 10 - 328
Target Start/End: Complemental strand, 3012651 - 3012340
Alignment:
| Q |
10 |
aagaaaattaaatggacttaatggaatgcttctttcatgtatgacaagtgaaaaatcaatgataatttgtccaaatttgcaagacttagtgctgaaacca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3012651 |
aagaaaattaaatggacttaatggaatgcttctttcatgtatgacaagtgaaaaatcaatgtcaatttgtccaaattcgcaagacttagtgctgaaacca |
3012552 |
T |
|
| Q |
110 |
tcaccataaactcttcaaaaatgtggaaaatcaagtaaatttcatggtagggggcgtagcaggctagcagccctatccagtacttagttttgtggttttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| | | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3012551 |
tcaccataaactcttcaaaaatgtggaaaatcaagtaaatttcatggcaggggg------acg-tagcagccctatccagtacttagttttgtggttttt |
3012459 |
T |
|
| Q |
210 |
ctctttgtgaattttaataatcttgtgtaattaggttcacttaactcatatggttgatgaatggaacgaagttagggtctcttgcggctataaaagggct |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3012458 |
ctctttgtgaattttaataatcttgtgtaattaggttcacttaactcatatggttgatgaatggaacgaagttagggtctctttcggctataaaagggct |
3012359 |
T |
|
| Q |
310 |
tgtagtcttggcatttcat |
328 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3012358 |
tgtagtcttggcatttcat |
3012340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University