View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16804_low_26 (Length: 259)

Name: NF16804_low_26
Description: NF16804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16804_low_26
NF16804_low_26
[»] chr2 (1 HSPs)
chr2 (37-183)||(307963-308109)


Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 37 - 183
Target Start/End: Original strand, 307963 - 308109
Alignment:
37 aaaattgagagggcatgagtggcaatgatatcaagaaagacgattgtgaacaaacacatttgaatgtgacttggatttccaccaatttgaagatgatgca 136  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
307963 aaaattgagagggcatgagtggcaatgatatcaagaaagacgattgtggacaaacacatttgaatgtgacttggatttccaccaatttgaagatgatgca 308062  T
137 aaccccacaagatatcaaggtcaattctattataacatctaattatt 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
308063 aaccccacaagatatcaaggtcaattctattataacatctaattatt 308109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University