View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16804_low_26 (Length: 259)
Name: NF16804_low_26
Description: NF16804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16804_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 37 - 183
Target Start/End: Original strand, 307963 - 308109
Alignment:
| Q |
37 |
aaaattgagagggcatgagtggcaatgatatcaagaaagacgattgtgaacaaacacatttgaatgtgacttggatttccaccaatttgaagatgatgca |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
307963 |
aaaattgagagggcatgagtggcaatgatatcaagaaagacgattgtggacaaacacatttgaatgtgacttggatttccaccaatttgaagatgatgca |
308062 |
T |
 |
| Q |
137 |
aaccccacaagatatcaaggtcaattctattataacatctaattatt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
308063 |
aaccccacaagatatcaaggtcaattctattataacatctaattatt |
308109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University