View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16804_low_27 (Length: 257)
Name: NF16804_low_27
Description: NF16804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16804_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 5 - 241
Target Start/End: Complemental strand, 54115035 - 54114799
Alignment:
| Q |
5 |
gagtgagatgaacatcaccgtttccaggcatatctacgatattcttcttcgccttcaccttcaatagtcgctcaagtatactcacaagtgtcggcaccgt |
104 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54115035 |
gagtgaaaggaacatcaccgtttccaggcatatctacgatattcttcttcgccttcaccttcaatagtcgctcaagtatactcacaagtgtcggcaccgt |
54114936 |
T |
 |
| Q |
105 |
caccggcgaagtattccccagattaaagatccgatacggtgctgctccacgtttcttcccacccgatccagtactcttaccagaagtatccaatgatcca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54114935 |
caccggcgaagtattccccagattaaagatccgatacggtgctgctccacgtttcttcccacctgatccagtactcttaccagaagtatccaatgatcca |
54114836 |
T |
 |
| Q |
205 |
acacatcccttcactatatcatcaatgtaggtgaagt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54114835 |
acacatcccttcactatatcatcaatgtaggtgaagt |
54114799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University