View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16805_low_10 (Length: 274)
Name: NF16805_low_10
Description: NF16805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16805_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 59 - 266
Target Start/End: Complemental strand, 38801472 - 38801265
Alignment:
| Q |
59 |
taccctattctcaacatgaaaagccatctcaatttgctcagggttgtgcaagacaccaccttcacccagctcttcgcgcataaagtccatttctactact |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38801472 |
taccctattctcaacatgaaaagccatctcaatttgctcagggttgtgcaagacaccaccttcacccagctcttcgcgcataaagtccatttctactact |
38801373 |
T |
|
| Q |
159 |
ggtagattttgggcaagtacctcctcttcttccactctcatatcttgttccccagactgatttgaattgtcggcatgatgatcactttgagaggttcttt |
258 |
Q |
| |
|
||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38801372 |
ggtggattttgggctagtacctcctcttcttctactctcatatcttgttccccagactgatttgaattgtcggcatgatgatcactttgagaggttcttt |
38801273 |
T |
|
| Q |
259 |
gatgatgt |
266 |
Q |
| |
|
| |||||| |
|
|
| T |
38801272 |
ggtgatgt |
38801265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 61 - 266
Target Start/End: Complemental strand, 38780293 - 38780085
Alignment:
| Q |
61 |
ccctattctcaacatgaaaagccatctcaatttgctcagggttgtgcaagacaccaccttcacccagctcttcgcgcataaagtccatttctact---ac |
157 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||||| ||||| |||||||||| || || || | ||| || ||||| ||||||||| || | || |
|
|
| T |
38780293 |
ccctattctcaacactgaaagtcatttcaatttgctctgggttctgcaagacacttccctctccaatctcctcacgcatcaagtccattcttagttccac |
38780194 |
T |
|
| Q |
158 |
tggtagattttgggcaagtacctcctcttcttccactctcatatcttgttccccagactgatttgaattgtcggcatgatgatcactttgagaggttctt |
257 |
Q |
| |
|
| || ||||||||| | | ||||| |||||| || ||||||||| |||| | |||||||||| || || ||||||||||||| |||||| |||||| |
|
|
| T |
38780193 |
tagtgtattttgggctattgtctcctgttcttctacactcatatctcgttcaactaactgatttgagttatcagcatgatgatcaccttgagaagttctt |
38780094 |
T |
|
| Q |
258 |
tgatgatgt |
266 |
Q |
| |
|
|||| |||| |
|
|
| T |
38780093 |
tgattatgt |
38780085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University