View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16805_low_12 (Length: 215)
Name: NF16805_low_12
Description: NF16805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16805_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 51845220 - 51845421
Alignment:
| Q |
1 |
tttgtgggaagccacttgacaaagcatgcgatccttcttcggatttaacgtcaccacctagcgatggatccggacaagatannnnnnnnnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51845220 |
tttgtgggaagccacttgacaaagcatgcgatccttcttcggatttaacgtcaccacctagcgatggatccggacaagatagtggtggtggtggtggtgg |
51845319 |
T |
 |
| Q |
101 |
nactggttgggctttaaagtttattggaattcttttggttgctgccttatttgttgtgtttgtcacgtttattaaatcgaaacgtagaaaggacgatgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51845320 |
tactggttgggctttaaagtttattggaattcttttggttgctgccttatttgttgtgtttgtcacgtttattaaatcgaaacgtagaaaggacgatgat |
51845419 |
T |
 |
| Q |
201 |
tt |
202 |
Q |
| |
|
|| |
|
|
| T |
51845420 |
tt |
51845421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University