View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16805_low_12 (Length: 215)

Name: NF16805_low_12
Description: NF16805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16805_low_12
NF16805_low_12
[»] chr4 (1 HSPs)
chr4 (1-202)||(51845220-51845421)


Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 51845220 - 51845421
Alignment:
1 tttgtgggaagccacttgacaaagcatgcgatccttcttcggatttaacgtcaccacctagcgatggatccggacaagatannnnnnnnnnnnnnnnnnn 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                       
51845220 tttgtgggaagccacttgacaaagcatgcgatccttcttcggatttaacgtcaccacctagcgatggatccggacaagatagtggtggtggtggtggtgg 51845319  T
101 nactggttgggctttaaagtttattggaattcttttggttgctgccttatttgttgtgtttgtcacgtttattaaatcgaaacgtagaaaggacgatgat 200  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51845320 tactggttgggctttaaagtttattggaattcttttggttgctgccttatttgttgtgtttgtcacgtttattaaatcgaaacgtagaaaggacgatgat 51845419  T
201 tt 202  Q
    ||    
51845420 tt 51845421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University