View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16805_low_9 (Length: 290)
Name: NF16805_low_9
Description: NF16805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16805_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 116 - 274
Target Start/End: Original strand, 40360641 - 40360799
Alignment:
| Q |
116 |
cactgtccctttaatgtttccctcctctgttttggtctctgcctcaactttctcatttgaatcaaccactttctcttctcttagatcaatgtctttgtta |
215 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40360641 |
cactgtcccttcaatatttccctcctctgttttggtctctgcctcaactttctcatttgaatcaaccactttctcttctcttagatcaatgtctttgtta |
40360740 |
T |
 |
| Q |
216 |
atgttaatcttctcctccttctcctccttctcctctgtagttttgcattcggagttttc |
274 |
Q |
| |
|
||||| |||||||||| ||||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
40360741 |
atgttcatcttctccttcttcttctcctcctcctccgtagttttgcattcggagttttc |
40360799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University