View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16806_low_12 (Length: 237)
Name: NF16806_low_12
Description: NF16806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16806_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 40663167 - 40663390
Alignment:
| Q |
1 |
ctcataaattttgtctaatacccgatagagtcttgtatattcttcaacttataatatcaaaattt-accattgtt-agctcacatcctatggtaaaattt |
98 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
40663167 |
ctcataaattttgactaataccctatagagtcttgtgtattcttcaacttataatatcaaaatttgaccattgttgaactcacatcctatggtaaaattt |
40663266 |
T |
|
| Q |
99 |
ctctatttatttaacttgtcccaagacaaatatgttggatc---agaggagcatgagaatcatcacattggattaataatgaccacataaatgaaattca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40663267 |
ctctatttatttaacttgtcccaagacaaatatgttggatcataagaggagcatgagaatcatcacattggattaataatgaccacataaatgaaattca |
40663366 |
T |
|
| Q |
196 |
acattaaatctttcaccagtaacatc |
221 |
Q |
| |
|
||| |||| ||||||||||||||| |
|
|
| T |
40663367 |
acactaaa--attcaccagtaacatc |
40663390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University