View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16806_low_8 (Length: 285)
Name: NF16806_low_8
Description: NF16806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16806_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 189 - 244
Target Start/End: Complemental strand, 55031741 - 55031686
Alignment:
| Q |
189 |
tgacatttgactacatatcgtacacattatacatgacacatgatcacaaattaata |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55031741 |
tgacatttgactacatatcgtacacattatacatgacacatgatcacaaattaata |
55031686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 132 - 190
Target Start/End: Complemental strand, 55031828 - 55031770
Alignment:
| Q |
132 |
gaggatggctgtgtttgtaccgttcgccttttcgttttgttaatttaactagtgtcatg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
55031828 |
gaggatggctgtgtttgtaccgttcgcgttttagttttgttaatttaactagtgtcatg |
55031770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 244
Target Start/End: Complemental strand, 37523813 - 37523763
Alignment:
| Q |
194 |
tttgactacatatcgtacacattatacatgacacatgatcacaaattaata |
244 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
37523813 |
tttgactacacgtcgtccacattctacatgacacataatcacaaattaata |
37523763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University