View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16807_high_9 (Length: 283)
Name: NF16807_high_9
Description: NF16807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16807_high_9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 9e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 17 - 103
Target Start/End: Complemental strand, 5832868 - 5832782
Alignment:
| Q |
17 |
aaaagtgccctaacattgttgaccttttcttcaatatggctgctggagagggtaagaatattgttcatttttaatcttacactatca |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5832868 |
aaaagtgccctaacattgttgaccttttcttcaatatggctgctggagagggtaagaatattgttcatttttaatcttacactatca |
5832782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 73
Target Start/End: Original strand, 5828901 - 5828943
Alignment:
| Q |
31 |
attgttgaccttttcttcaatatggctgctggagagggtaaga |
73 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
5828901 |
attgttgaccttttctttaatttggctgctggagaaggtaaga |
5828943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 71
Target Start/End: Complemental strand, 5822976 - 5822936
Alignment:
| Q |
31 |
attgttgaccttttcttcaatatggctgctggagagggtaa |
71 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
5822976 |
attgttgaccttttctttaatttggctgctggagaaggtaa |
5822936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 86
Target Start/End: Complemental strand, 24038489 - 24038420
Alignment:
| Q |
16 |
caaaagtgccctaacattgttgaccttttcttcaatatggctgctggagagggtaagaatattgttcattt |
86 |
Q |
| |
|
||||| ||||| || ||||||||||||| ||||||| |||||||||| || |||||| ||||| ||||||| |
|
|
| T |
24038489 |
caaaattgccccaatattgttgacctttacttcaatttggctgctggggaaggtaag-atatttttcattt |
24038420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 283
Target Start/End: Complemental strand, 7328770 - 7328726
Alignment:
| Q |
239 |
gacacatatattgacacgtcgataccgctaataatttgagaaaat |
283 |
Q |
| |
|
|||||| | ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
7328770 |
gacacagacattaacacgtcgatactgctaataatttgagaaaat |
7328726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 250 - 283
Target Start/End: Original strand, 13851727 - 13851760
Alignment:
| Q |
250 |
tgacacgtcgataccgctaataatttgagaaaat |
283 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
13851727 |
tgacacgtcgacaccgctaataatttgagaaaat |
13851760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 251 - 283
Target Start/End: Original strand, 34897077 - 34897109
Alignment:
| Q |
251 |
gacacgtcgataccgctaataatttgagaaaat |
283 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
34897077 |
gacacgtcgacaccgctaataatttgagaaaat |
34897109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University