View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16807_low_11 (Length: 276)
Name: NF16807_low_11
Description: NF16807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16807_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 129 - 263
Target Start/End: Original strand, 46754752 - 46754886
Alignment:
| Q |
129 |
ggccccttgattgtgtaaccaatggttgtctacaataattttccattcttttttctcagtttattttcgtgtacacaacatcgataatctttcccggcat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46754752 |
ggccccttgattgtgtaaccaatggttgtctacaacaattttccattcttttttctcagtttattttcgtgtacacaacatcgataatctttcccggcat |
46754851 |
T |
 |
| Q |
229 |
agctgtatgaggttgacggttaggacaaatatttt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
46754852 |
agctgtatgaggttgacggttaggacaaatatttt |
46754886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 15 - 86
Target Start/End: Original strand, 46754638 - 46754709
Alignment:
| Q |
15 |
cataggagagtaaatcattagatggctaacaatttgctagacaggtgctttgacttgtgtatgttgtgtata |
86 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46754638 |
cataggagagtaaatcagtagatggctaacaatttgctagacaggtgctttgacttgtgtatgttgtgtata |
46754709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University